yjeH Gene Page

Genbank name: yjeH
EcoGene name: yjeH
Divergent gene: groS
Species with an ortholog: EC   SP   ST   VC   YP   
EcoGene link: EG12470

Species that contributed to the solution: EC ST
Total number of sites in the solution: 2
Number of E. coli sites in the solution: 1
Map value: 11.06
Model logo: yjeH.1.model.LGO.gif
Sequence logo: yjeH.1.LGO.gif
Sequence Alignment: yjeH.1.ALGN
Solution location in genomic coordinates: 4368151-4368169 R
Solution sequence with flanking nucleotides: aggct TCGCCCCTTCAAGGGGGAA aaaga
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC SP ST
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 1
Map value: 8.18
Model logo: yjeH.2.model.LGO.gif
Sequence logo: yjeH.2.LGO.gif
Sequence Alignment: yjeH.2.ALGN
Solution location in genomic coordinates: 4368185-4368206 R
Solution sequence with flanking nucleotides: cgtgg TTTCCCGGCTGGTGACCAGAGA aatgg
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC SP ST VC YP
Total number of sites in the solution: 6
Number of E. coli sites in the solution: 1
Map value: 7.12
Model logo: yjeH.3.model.LGO.gif
Sequence logo: yjeH.3.LGO.gif
Sequence Alignment: yjeH.3.ALGN
Solution location in genomic coordinates: 4368103-4368123 R
Solution sequence with flanking nucleotides: cacaa AATCGGGTGAAAACCCTGATT cacct
Number of overlapping basepairs with reported site: 0
Site type:


Gene Index Page