yjeQ Gene Page

Genbank name: yjeQ
EcoGene name: yjeQ
Divergent gene: orn
Species with an ortholog: EC HI PA SP ST VC YP
EcoGene link: EG12479

Species that contributed to the solution: EC SP ST VC YP
Total number of sites in the solution: 5
Number of E. coli sites in the solution: 1
Map value: 15.89
Model logo: yjeQ.1.model.LGO.gif
Sequence logo: yjeQ.1.LGO.gif
Sequence Alignment: yjeQ.1.ALGN
Solution location in genomic coordinates: 4389049-4389065 R
Solution sequence with flanking nucleotides: ctcca AAGGCCAGCAGCGCCGC
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC HI SP ST VC YP
Total number of sites in the solution: 6
Number of E. coli sites in the solution: 1
Map value: 13.35
Model logo: yjeQ.2.model.LGO.gif
Sequence logo: yjeQ.2.LGO.gif
Sequence Alignment: yjeQ.2.ALGN
Solution location in genomic coordinates: 4389074-4389092 R
Solution sequence with flanking nucleotides: gtctg TACGATTGAGTAAAAATAA actct
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC ST
Total number of sites in the solution: 2
Number of E. coli sites in the solution: 1
Map value: 6.23
Model logo: yjeQ.3.model.LGO.gif
Sequence logo: yjeQ.3.LGO.gif
Sequence Alignment: yjeQ.3.ALGN
Solution location in genomic coordinates: 4389093-4389112 R
Solution sequence with flanking nucleotides: CAGGGGCGACCAGGAGTCTG tacga
Number of overlapping basepairs with reported site: 0
Site type:

Gene Index Page