yjhF Gene Page

Genbank name: yjhF
EcoGene name: yjhF
Divergent gene:
Species with an ortholog: EC   ST   YP   
EcoGene link: EG12548

Species that contributed to the solution: EC ST
Total number of sites in the solution: 2
Number of E. coli sites in the solution: 1
Map value: 4.28
Model logo: yjhF.1.model.LGO.gif
Sequence logo: yjhF.1.LGO.gif
Sequence Alignment: yjhF.1.ALGN
Solution location in genomic coordinates: 4519644-4519665 R
Solution sequence with flanking nucleotides: acctg AATTATCCGACTCTGCATCATT cgtta
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: yjhF_yjhG_IR     Overlap: 21

Species that contributed to the solution: EC ST
Total number of sites in the solution: 3
Number of E. coli sites in the solution: 2
Map value: 2.72
Model logo: yjhF.2.model.LGO.gif
Sequence logo: yjhF.2.LGO.gif
Sequence Alignment: yjhF.2.ALGN
Solution location in genomic coordinates: 4519675-4519692 R
Solution sequence with flanking nucleotides: tgaaa GCATAAATAAAAACATCC agaca
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 4519634-4519651 R
Solution sequence with flanking nucleotides: actct GCATCATTCGTTATTTGC tcagt
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: yjhF_yjhG_IR     Overlap: 18


Gene Index Page