yjhU Gene Page
Genbank name: yjhU
EcoGene name: yjhU
Divergent gene:
Species with an ortholog:
EC YP
EcoGene link: EG12604
Species that contributed to the solution: EC YP
Total number of sites in the solution: 2
Number of E. coli sites in the solution: 1
Map value: 3.09
Model logo: yjhU.1.model.LGO.gif
Sequence logo: yjhU.1.LGO.gif
Sequence Alignment: yjhU.1.ALGN
Solution location in genomic coordinates: 4517994-4518013 R
Solution sequence with flanking nucleotides: gctgg TTTATTTCATGTAAAAGAAT aaaat
Number of overlapping basepairs with reported site: 0
Site type:
Gene Index Page