yjiT Gene Page

Genbank name: yjiT
EcoGene name: yjiT
Divergent gene:
Species with an ortholog: EC   ST   
EcoGene link: EG12581

Species that contributed to the solution: EC ST
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 2
Map value: 14.16
Model logo: yjiT.1.model.LGO.gif
Sequence logo: yjiT.1.LGO.gif
Sequence Alignment: yjiT.1.ALGN
Solution location in genomic coordinates: 4569769-4569790
Solution sequence with flanking nucleotides: tgaga TTTATTTTCATTTGAAATTATA aaatc
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 4569832-4569853
Solution sequence with flanking nucleotides: ttgat ATCATTTTTATCTAAAATTGAT ttata
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC ST
Total number of sites in the solution: 2
Number of E. coli sites in the solution: 1
Map value: 7.17
Model logo: yjiT.2.model.LGO.gif
Sequence logo: yjiT.2.LGO.gif
Sequence Alignment: yjiT.2.ALGN
Solution location in genomic coordinates: 4569533-4569549
Solution sequence with flanking nucleotides: taaat TAAGTTATAAAAATTTT cccga
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC ST
Total number of sites in the solution: 2
Number of E. coli sites in the solution: 1
Map value: 1.73
Model logo: yjiT.3.model.LGO.gif
Sequence logo: yjiT.3.LGO.gif
Sequence Alignment: yjiT.3.ALGN
Solution location in genomic coordinates: 4569503-4569524
Solution sequence with flanking nucleotides: tttat ATATAATAAAACGTTTTTATGT tttta
Number of overlapping basepairs with reported site: 0
Site type:


Gene Index Page