yjjI Gene Page
Genbank name: yjjI
EcoGene name: yjjI
Divergent gene: deoC
Species with an ortholog:
EC SP ST
EcoGene link: EG12171
Species that contributed to the solution: EC ST
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 2
Map value: 16.40
Model logo: yjjI.1.model.LGO.gif
Sequence logo: yjjI.1.LGO.gif
Sequence Alignment: yjjI.1.ALGN
Solution location in genomic coordinates: 4614797-4614816 R
Solution sequence with flanking nucleotides: aacac ACTTCGATACACATCACAAT taagg
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 4614744-4614763 R
Solution sequence with flanking nucleotides: actgt AATGCGATCTGGTTCAAATA attca
Number of overlapping basepairs with reported site: 0
Site type:
Species that contributed to the solution: EC ST
Total number of sites in the solution: 2
Number of E. coli sites in the solution: 1
Map value: 11.28
Model logo: yjjI.2.model.LGO.gif
Sequence logo: yjjI.2.LGO.gif
Sequence Alignment: yjjI.2.ALGN
Solution location in genomic coordinates: 4614832-4614847 R
Solution sequence with flanking nucleotides: gagtt TGTTAGTATTCTAACA tctac
Number of overlapping basepairs with reported site: 0
Site type:
Species that contributed to the solution: EC ST
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 2
Map value: 6.02
Model logo: yjjI.3.model.LGO.gif
Sequence logo: yjjI.3.LGO.gif
Sequence Alignment: yjjI.3.ALGN
Solution location in genomic coordinates: 4614843-4614863 R
Solution sequence with flanking nucleotides: ataaa ATTCACCTTGCGAGTTTGTTA gtatt
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 4614770-4614790 R
Solution sequence with flanking nucleotides: aagga AATCTACTTACAAGTTTGCAT cactg
Number of overlapping basepairs with reported site: 0
Site type:
Gene Index Page