yojH Gene Page

Genbank name: yojH
EcoGene name: yojH
Divergent gene:
Species with an ortholog: EC   PA   
EcoGene link: EG12069

Species that contributed to the solution: EC PA
Total number of sites in the solution: 3
Number of E. coli sites in the solution: 2
Map value: 1.99
Model logo: yojH.1.model.LGO.gif
Sequence logo: yojH.1.LGO.gif
Sequence Alignment: yojH.1.ALGN
Solution location in genomic coordinates: 2304915-2304935 R
Solution sequence with flanking nucleotides: atccc TTCATTTCTAATAACCCTATA attaa
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 2304879-2304899 R
Solution sequence with flanking nucleotides: gaaat TATAATGTTTCTAAAATTAGA atata
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: yojH_yojI_IR     Overlap: 20

Species that contributed to the solution: EC PA
Total number of sites in the solution: 3
Number of E. coli sites in the solution: 1
Map value: 1.14
Model logo: yojH.2.model.LGO.gif
Sequence logo: yojH.2.LGO.gif
Sequence Alignment: yojH.2.ALGN
Solution location in genomic coordinates: 2304960-2304983 R
Solution sequence with flanking nucleotides: tacga CGCTGACCTGGCGGACTGCTGCCG tcagg
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC
Total number of sites in the solution: 2
Number of E. coli sites in the solution: 2
Map value: -0.00
Model logo: yojH.3.model.LGO.gif
Sequence logo: yojH.3.LGO.gif
Sequence Alignment: yojH.3.ALGN
Solution location in genomic coordinates: 2304881-2304897 R
Solution sequence with flanking nucleotides: aatta TAATGTTTCTAAAATTA gaata
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: yojH_yojI_IR     Overlap: 17
Solution location in genomic coordinates: 2304860-2304876 R
Solution sequence with flanking nucleotides: agaat ATAATTTATAAACATTA tttaa
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: yojH_yojI_IR     Overlap: 17


Gene Index Page