yojI Gene Page

Genbank name: yojI
EcoGene name: yojI
Divergent gene:
Species with an ortholog: EC HI PA SP ST VC
EcoGene link: EG12070

Species that contributed to the solution: EC ST
Total number of sites in the solution: 2
Number of E. coli sites in the solution: 1
Map value: 14.18
Model logo: yojI.1.model.LGO.gif
Sequence logo: yojI.1.LGO.gif
Sequence Alignment: yojI.1.ALGN
Solution location in genomic coordinates: 2306694-2306709 R
Solution sequence with flanking nucleotides: taaa AATAAGAATTATTATT gctgt
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC HI PA SP ST VC
Total number of sites in the solution: 9
Number of E. coli sites in the solution: 2
Map value: 11.99
Model logo: yojI.2.model.LGO.gif
Sequence logo: yojI.2.LGO.gif
Sequence Alignment: yojI.2.ALGN
Solution location in genomic coordinates: 2306689-2306711 R
Solution sequence with flanking nucleotides: ta AAAATAAGAATTATTATTGCTGT gcgcg
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 2306650-2306672 R
Solution sequence with flanking nucleotides: tgttt AAACTGCGGGCTGTAATTCATTG tccgg
Number of overlapping basepairs with reported site: 0
Site type:

Gene Index Page