yrfD Gene Page

Genbank name: yrfD
EcoGene name: yrfD
Divergent gene: mrcA
Species with an ortholog: EC   ST   
EcoGene link: EG12925

Species that contributed to the solution: EC ST
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 2
Map value: 24.89
Model logo: yrfD.1.model.LGO.gif
Sequence logo: yrfD.1.LGO.gif
Sequence Alignment: yrfD.1.ALGN
Solution location in genomic coordinates: 3520463-3520482 R
Solution sequence with flanking nucleotides: tt GGGCAGTTTATAAACAAACG cgcgg
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 3520441-3520460 R
Solution sequence with flanking nucleotides: acgcg CGGTAGTATAAAGGCAAGCC agacg
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC ST
Total number of sites in the solution: 2
Number of E. coli sites in the solution: 1
Map value: 16.82
Model logo: yrfD.2.model.LGO.gif
Sequence logo: yrfD.2.LGO.gif
Sequence Alignment: yrfD.2.ALGN
Solution location in genomic coordinates: 3520451-3520472 R
Solution sequence with flanking nucleotides: gttta TAAACAAACGCGCGGTAGTATA aaggc
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC ST
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 2
Map value: 12.32
Model logo: yrfD.3.model.LGO.gif
Sequence logo: yrfD.3.LGO.gif
Sequence Alignment: yrfD.3.ALGN
Solution location in genomic coordinates: 3520446-3520461 R
Solution sequence with flanking nucleotides: aacgc GCGGTAGTATAAAGGC aagcc
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 3520421-3520436 R
Solution sequence with flanking nucleotides: cagac GCATTGATATACCCGT caga
Number of overlapping basepairs with reported site: 0
Site type:


Gene Index Page