ytfF Gene Page
Genbank name: ytfF
EcoGene name: ytfF
Divergent gene:
Species with an ortholog:
EC ST
EcoGene link: EG12506
Species that contributed to the solution: EC ST
Total number of sites in the solution: 2
Number of E. coli sites in the solution: 1
Map value: 6.25
Model logo: ytfF.1.model.LGO.gif
Sequence logo: ytfF.1.LGO.gif
Sequence Alignment: ytfF.1.ALGN
Solution location in genomic coordinates: 4430697-4430713 R
Solution sequence with flanking nucleotides: catcc TCTCTGATAATGACGGG atgcc
Number of overlapping basepairs with reported site: 0
Site type:
Species that contributed to the solution: EC
Total number of sites in the solution: 1
Number of E. coli sites in the solution: 1
Map value: 2.28
Model logo: ytfF.2.model.LGO.gif
Sequence logo:
Sequence Alignment: ytfF.2.ALGN
Solution location in genomic coordinates: 4430673-4430688 R
Solution sequence with flanking nucleotides: ccggg AGCAATCATGTCTGCT tcctg
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 4430648-4430669 R
Solution sequence with flanking nucleotides: cttcc TGAACTTTCTTCTGACAGATCA atgg
Number of overlapping basepairs with reported site: 0
Site type:
Gene Index Page