ytfK Gene Page

Genbank name: ytfK
EcoGene name: ytfK
Divergent gene: ytfJ
Species with an ortholog: EC   ST   YP   
EcoGene link: EG12511

Species that contributed to the solution: EC ST YP
Total number of sites in the solution: 5
Number of E. coli sites in the solution: 2
Map value: 12.36
Model logo: ytfK.1.model.LGO.gif
Sequence logo: ytfK.1.LGO.gif
Sequence Alignment: ytfK.1.ALGN
Solution location in genomic coordinates: 4437007-4437024
Solution sequence with flanking nucleotides: aaaag ATAATTCTGAATAATTGT aacct
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 4437077-4437094
Solution sequence with flanking nucleotides: agtct ATAGTCACTAAGCATTAA aattt
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC ST
Total number of sites in the solution: 2
Number of E. coli sites in the solution: 1
Map value: 10.66
Model logo: ytfK.2.model.LGO.gif
Sequence logo: ytfK.2.LGO.gif
Sequence Alignment: ytfK.2.ALGN
Solution location in genomic coordinates: 4436863-4436879
Solution sequence with flanking nucleotides: tatgc AGGTGATCCGACCACTT gggtc
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC ST
Total number of sites in the solution: 2
Number of E. coli sites in the solution: 1
Map value: 7.71
Model logo: ytfK.3.model.LGO.gif
Sequence logo: ytfK.3.LGO.gif
Sequence Alignment: ytfK.3.ALGN
Solution location in genomic coordinates: 4436921-4436943
Solution sequence with flanking nucleotides: tttcc CGCAAGTGTGATGCCAGTTTGCG gtcaa
Number of overlapping basepairs with reported site: 0
Site type:


Gene Index Page