ytfL Gene Page

Genbank name: ytfL
EcoGene name: ytfL
Divergent gene:
Species with an ortholog: EC   HI   SP   ST   TF   VC   YP   
EcoGene link: EG12512

Species that contributed to the solution: EC ST YP
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 1
Map value: 10.12
Model logo: ytfL.1.model.LGO.gif
Sequence logo: ytfL.1.LGO.gif
Sequence Alignment: ytfL.1.ALGN
Solution location in genomic coordinates: 4438901-4438924 R
Solution sequence with flanking nucleotides: cggct TTACAGTACCTTACGCTATACTAG ccact
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC SP ST
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 2
Map value: 8.55
Model logo: ytfL.2.model.LGO.gif
Sequence logo: ytfL.2.LGO.gif
Sequence Alignment: ytfL.2.ALGN
Solution location in genomic coordinates: 4438965-4438983 R
Solution sequence with flanking nucleotides: tcggc ATAGCGTATCAGGCAGTTT tgcat
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: REPv335a     Overlap: 14
Solution location in genomic coordinates: 4438906-4438924 R
Solution sequence with flanking nucleotides: cggct TTACAGTACCTTACGCTAT actag
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC HI SP TF VC
Total number of sites in the solution: 7
Number of E. coli sites in the solution: 1
Map value: 8.24
Model logo: ytfL.3.model.LGO.gif
Sequence logo: ytfL.3.LGO.gif
Sequence Alignment: ytfL.3.ALGN
Solution location in genomic coordinates: 4439016-4439036 R
Solution sequence with flanking nucleotides: aggcc TACAAAATCGTCCAAATTCAA tatat
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: IHFr335     Overlap: 18
Repeat: REP335b     Overlap: 3


Gene Index Page