Gibbs.linux Mtb_7seq.fa 16 -n -r -R 1,1,8 -M 1,24 -E 3 -S 20 -m -y -nopt -bayes 1000,5000 -align_centroid -B Mtb_7seq.fa_info-det -o Mtb_7seq.12.out -P reg.0805.pr Gibbs 3.01.002 Feb 19 2007 Data file: Mtb_7seq.fa Output file: Mtb_7seq.12.out Priors file: reg.0805.pr Background Composition Model file: Mtb_7seq.fa_info-det Current directory: /home/leeann/Gibbs_tests The following options are set: Concentrated Region False Sequence type False Collapsed Alphabet False Pseudocount weight False Use Expectation/Maximization False Don't Xnu sequence False Help flag False Near optimal cutoff False Number of iterations False Don't fragment False Don't use map maximization True Repeat regions False Output file True Informed priors file True Plateau periods False palindromic sequence True Don't Reverse complement True Number of seeds True Seed Value False Pseudosite weight False Suboptimal sampler output False Overlap False Allow width to vary False Wilcoxon signed rank False Sample along length False Output Scan File False Output prior file False Modular Sampler True Ignore Spacing Model False Sample Background False Bkgnd Comp Model True Init from prior False Homologous Seq pairs False Parallel Tempering False Group Sampler False No progress info False Fragment from middle False Verify Mode False Alternate sample on k False No freq. soln. True Calc. def. pseudo wt. False Motif/Recur smpl False Phylogenetic Sampling False Supress Near Opt. True Nearopt display cutoff False Sample model True Hierarchical Model False Centroid model True Print Bayesian Counts False Align Centroid True site_samp = 0 nMotifLen = 16 nAlphaLen = 4 nNumMotifs = 7 dPseudoCntWt = 0.1 dPseudoSiteWt = 0.8 nMaxIterations = 500 lSeedVal = 1175893431 nPlateauPeriods = 20 nSeeds = 20 nNumMotifTypes = 1 dCutoff = 0.01 dNearOptDispCutoff = 0.5 RevComplement = 0 glOverlapParam = 0 Max Sites/seq = 3 Min Sites/Seq = 0 Rcutoff factor = 0 Post Plateau Samples = 0 Frag/Shft Per. = 5 Frag width = 24 Burn-in = 1000 Sample Period = 5000 Sequences to be Searched: _________________________ #1 hspX complement(2278496..2278930) Rv2032 2279127..2280122 5UTR genome coordinates=2278931-2279126 length=196 #2 Rv3130c complement(3494972..3496363) Rv3131 3496548..3497546 5UTR genome coordinates=3496364-3496547 length=184 #3 Rv2005c complement(2250994..2251881) otsB 2252000..2255983 5UTR genome coordinates=2251882-2251999 length=118 #4 Rv2623 2949591..2950484 Rv2622 2948634..2949455 5UTR genome coordinates=2949456-2949590 length=135 #5 narK2 complement(1964181..1965368) Rv1738 1965655..1965939 5UTR genome coordinates=1965369-1965654 length=286 #6 Rv1733c complement(1959853..1960485) Rv1734c complement(1960772..1961014) 5UTR genome coordinates=1960486-1960771 length=286 #7 Rv3127 3492144..3493178 Rv3125c complement(3490473..3491648) 5UTR genome coordinates=3491649-3492143 length=495 Processed Sequence Length: 1700 Total sequence length: 1700 ====================================================================== ========================== CENTROID RESULTS ========================== ====================================================================== 1, 1 54 catcg TGGCCAGGGCTAGGGACAGAAGT ccccg 76 0.74 hspX complement(2278496..2278930) Rv2032 2279127.. 1, 2 82 ccccg AAGCGCGGGCCATTTGTCCGC gcccg 102 0.76 hspX complement(2278496..2278930) Rv2032 2279127.. 1, 3 118 gatcc ACTTGGGGACCATTGACCCTGTT gtctg 140 0.72 hspX complement(2278496..2278930) Rv2032 2279127.. 2, 1 76 tgagg CAGGGCCAAAGGTCCTCCGCTGG cgagc 98 0.94 Rv3130c complement(3494972..3496363) Rv3131 349654 3, 1 50 caccg GTCATGAGGCTTTAGTCCCCAATC ggacg 73 0.71 Rv2005c complement(2250994..2251881) otsB 2252000. 4, 1 10 ttgag GACCTAAGCCCGTTGGGCT agtga 28 0.85 Rv2623 2949591..2950484 Rv2622 2948634..2949455 4, 2 29 gggct AGTGACAAACGCCTCCTGAGC aaaac 49 0.53 Rv2623 2949591..2950484 Rv2622 2948634..2949455 5, 1 94 agtta GGGCCGGAAGTCCCCAATGTG gcaga 114 0.92 narK2 complement(1964181..1965368) Rv1738 1965655. 5, 2 124 acctt TCGCCCCTGGCGGACGAATGACC ccagt 146 0.71 narK2 complement(1964181..1965368) Rv1738 1965655. 5, 3 149 acccc AGTGGCCGGGACTTCAGGCCC tatcg 169 0.88 narK2 complement(1964181..1965368) Rv1738 1965655. 6, 1 18 ctcgt GGCTCCTAGGGTCGTTCGGCC ttggg 38 0.69 Rv1733c complement(1959853..1960485) Rv1734c compl 6, 2 39 cggcc TTGGGGCTGGGGACGTCGGTCAC gaatg 61 0.65 Rv1733c complement(1959853..1960485) Rv1734c compl 6, 3 121 ttatt GTCGGATAAGGGACTTTCGCCCCT tcccg 144 0.72 Rv1733c complement(1959853..1960485) Rv1734c compl 7, 1 426 ggatt TCATTGAGAGGACCAATGACCCT atttg 448 0.76 Rv3127 3492144..3493178 Rv3125c complement(3490473 Num Sites: 14 Column 1 : Sequence Number, Site Number Column 2 : Left End Location Column 4 : Motif Element Column 6 : Right End Location Column 7 : Probability of Element Column 8 : Sequence Description from FastA input ====================================================================== ======================== Aligned Centroid Sites ====================== ====================================================================== ------------------------------------------------------------------------- MOTIF a Motif model (residue frequency x 100) ____________________________________________ Pos. # a t c g Info _____________________________ 1 | 21 50 14 14 0.3 2 | 42 7 14 35 0.3 3 | 14 . 7 78 0.7 4 | 7 7 . 85 0.8 5 | . . . 100 1.3 6 | 64 7 21 7 0.7 7 | . . 100 . 1.3 9 | 35 50 . 14 0.6 10 | 50 35 14 . 0.7 12 | . . . 100 1.3 13 | 21 42 21 14 0.2 14 | . . 100 . 1.3 15 | 7 7 85 . 0.9 16 | . 14 71 14 0.5 17 | . 42 50 7 0.5 18 | 42 21 7 28 0.3 nonsite 18 20 29 31 site 19 17 31 31 Motif probability model ____________________________________________ Pos. # a t c g ____________________________________________ 1 | 0.211 0.473 0.157 0.159 2 | 0.406 0.084 0.157 0.353 3 | 0.146 0.019 0.092 0.743 4 | 0.082 0.084 0.027 0.808 5 | 0.017 0.019 0.027 0.938 6 | 0.601 0.084 0.222 0.094 7 | 0.017 0.019 0.936 0.029 9 | 0.341 0.473 0.027 0.159 10 | 0.471 0.343 0.157 0.029 12 | 0.017 0.019 0.027 0.938 13 | 0.211 0.408 0.222 0.159 14 | 0.017 0.019 0.936 0.029 15 | 0.082 0.084 0.806 0.029 16 | 0.017 0.148 0.676 0.159 17 | 0.017 0.408 0.482 0.094 18 | 0.406 0.213 0.092 0.288 Background probability model 0.173 0.230 0.279 0.319 16 columns Num Motifs: 14 1, 1 64 agggc TAGGGACAGAAGTCCCCG aagcg 81 1.00 F hspX complement(2278496..2278930) Rv2032 2279127.. 1, 2 86 gaagc GCGGGCCATTTGTCCGCG cccgt 103 1.00 F hspX complement(2278496..2278930) Rv2032 2279127.. 1, 3 121 ccact TGGGGACCATTGACCCTG ttgtc 138 1.00 F hspX complement(2278496..2278930) Rv2032 2279127.. 2, 1 76 tgagg CAGGGCCAAAGGTCCTCC gctgg 93 1.00 F Rv3130c complement(3494972..3496363) Rv3131 349654 3, 1 53 cggtc ATGAGGCTTTAGTCCCCA atcgg 70 1.00 F Rv2005c complement(2250994..2251881) otsB 2252000. 4, 1 6 tccat TGAGGACCTAAGCCCGTT gggct 23 1.00 F Rv2623 2949591..2950484 Rv2622 2948634..2949455 4, 2 28 tgggc TAGTGACAAACGCCTCCT gagca 45 1.00 F Rv2623 2949591..2950484 Rv2622 2948634..2949455 5, 1 92 tcagt TAGGGCCGGAAGTCCCCA atgtg 109 1.00 F narK2 complement(1964181..1965368) Rv1738 1965655. 5, 2 132 cccct GGCGGACGAATGACCCCA gtggc 149 1.00 F narK2 complement(1964181..1965368) Rv1738 1965655. 5, 3 154 agtgg CCGGGACTTCAGGCCCTA tcgga 171 1.00 F narK2 complement(1964181..1965368) Rv1738 1965655. 6, 1 24 gctcc TAGGGTCGTTCGGCCTTG gggct 41 1.00 F Rv1733c complement(1959853..1960485) Rv1734c compl 6, 2 46 ggggc TGGGGACGTCGGTCACGA atggc 63 1.00 F Rv1733c complement(1959853..1960485) Rv1734c compl 6, 3 128 cggat AAGGGACTTTCGCCCCTT cccgc 145 1.00 F Rv1733c complement(1959853..1960485) Rv1734c compl 7, 1 432 cattg AGAGGACCAATGACCCTA tttga 449 1.00 F Rv3127 3492144..3493178 Rv3125c complement(3490473 ******* ** ******* Column 1 : Sequence Number, Site Number Column 2 : Left End Location Column 4 : Motif Element Column 6 : Right End Location Column 7 : Probability of Element Column 8 : Forward Motif (F) or Reverse Complement (R) Column 9 : Sequence Description from Fast A input Elapsed time: 493.110000 secs