Gibbs.linux Mtb_7seq.fa 16 -n -r -R 1,1,8 -M 1,24 -E 3 -S 20 -m -y -nopt -bayes 1000,5000 -align_centroid -B Mtb_7seq.fa_info-det -o Mtb_7seq.14.out -P reg.0805.pr -l Gibbs 3.01.002 Feb 19 2007 Data file: Mtb_7seq.fa Output file: Mtb_7seq.14.out Priors file: reg.0805.pr Background Composition Model file: Mtb_7seq.fa_info-det Current directory: /home/leeann/Gibbs_tests The following options are set: Concentrated Region False Sequence type False Collapsed Alphabet False Pseudocount weight False Use Expectation/Maximization False Don't Xnu sequence False Help flag False Near optimal cutoff False Number of iterations False Don't fragment False Don't use map maximization True Repeat regions False Output file True Informed priors file True Plateau periods False palindromic sequence True Don't Reverse complement True Number of seeds True Seed Value False Pseudosite weight False Suboptimal sampler output False Overlap False Allow width to vary False Wilcoxon signed rank True Sample along length False Output Scan File False Output prior file False Modular Sampler True Ignore Spacing Model False Sample Background False Bkgnd Comp Model True Init from prior False Homologous Seq pairs False Parallel Tempering False Group Sampler False No progress info False Fragment from middle False Verify Mode False Alternate sample on k False No freq. soln. True Calc. def. pseudo wt. False Motif/Recur smpl False Phylogenetic Sampling False Supress Near Opt. True Nearopt display cutoff False Sample model True Hierarchical Model False Centroid model True Print Bayesian Counts False Align Centroid True site_samp = 0 nMotifLen = 16 nAlphaLen = 4 nNumMotifs = 14 dPseudoCntWt = 0.1 dPseudoSiteWt = 0.8 nMaxIterations = 500 lSeedVal = 1176147025 nPlateauPeriods = 20 nSeeds = 20 nNumMotifTypes = 1 dCutoff = 0.01 dNearOptDispCutoff = 0.5 RevComplement = 0 glOverlapParam = 0 Max Sites/seq = 3 Min Sites/Seq = 0 Rcutoff factor = 0 Post Plateau Samples = 0 Frag/Shft Per. = 5 Frag width = 24 Burn-in = 1000 Sample Period = 5000 Sequences to be Searched: _________________________ #1 hspX complement(2278496..2278930) Rv2032 2279127..2280122 5UTR genome coordinates=2278931-2279126 length=196 #2 Rv3130c complement(3494972..3496363) Rv3131 3496548..3497546 5UTR genome coordinates=3496364-3496547 length=184 #3 Rv2005c complement(2250994..2251881) otsB 2252000..2255983 5UTR genome coordinates=2251882-2251999 length=118 #4 Rv2623 2949591..2950484 Rv2622 2948634..2949455 5UTR genome coordinates=2949456-2949590 length=135 #5 narK2 complement(1964181..1965368) Rv1738 1965655..1965939 5UTR genome coordinates=1965369-1965654 length=286 #6 Rv1733c complement(1959853..1960485) Rv1734c complement(1960772..1961014) 5UTR genome coordinates=1960486-1960771 length=286 #7 Rv3127 3492144..3493178 Rv3125c complement(3490473..3491648) 5UTR genome coordinates=3491649-3492143 length=495 #8 Wilcoxon Shuffled Sequence 1 #9 Wilcoxon Shuffled Sequence 2 #10 Wilcoxon Shuffled Sequence 3 #11 Wilcoxon Shuffled Sequence 4 #12 Wilcoxon Shuffled Sequence 5 #13 Wilcoxon Shuffled Sequence 6 #14 Wilcoxon Shuffled Sequence 7 Processed Sequence Length: 3400 Total sequence length: 3400 ====================================================================== ========================== CENTROID RESULTS ========================== ====================================================================== 1, 1 54 catcg TGGCCAGGGCTAGGGACAGAAGT ccccg 76 0.86 hspX complement(2278496..2278930) Rv2032 2279127.. 1, 2 89 gcgcg GGCCATTTGTCCGCGCCCGTCGG tgatc 111 0.76 hspX complement(2278496..2278930) Rv2032 2279127.. 1, 3 117 tgatc CACTTGGGGACCATTGACCCTGT tgtct 139 0.87 hspX complement(2278496..2278930) Rv2032 2279127.. 2, 1 68 ggagc CGTTGAGGCAGGGCCAAAGGTCC tccgc 90 0.86 Rv3130c complement(3494972..3496363) Rv3131 349654 3, 1 44 gacag TCACCGGTCATGAGGCTTTAGTC cccaa 66 0.70 Rv2005c complement(2250994..2251881) otsB 2252000. 4, 1 10 ttgag GACCTAAGCCCGTTGGGCTAG tgaca 30 0.86 Rv2623 2949591..2950484 Rv2622 2948634..2949455 4, 2 31 gctag TGACAAACGCCTCCTGAGCAA aaccc 51 0.64 Rv2623 2949591..2950484 Rv2622 2948634..2949455 5, 1 88 cggct CAGTTAGGGCCGGAAGTCCCCAA tgtgg 110 0.85 narK2 complement(1964181..1965368) Rv1738 1965655. 5, 2 137 ggcgg ACGAATGACCCCAGTGGCCGGGA cttca 159 0.74 narK2 complement(1964181..1965368) Rv1738 1965655. 5, 3 160 cggga CTTCAGGCCCTATCGGAGGGC tccgg 180 0.76 narK2 complement(1964181..1965368) Rv1738 1965655. 6, 1 16 tgctc GTGGCTCCTAGGGTCGTTCGGCC ttggg 38 0.77 Rv1733c complement(1959853..1960485) Rv1734c compl 6, 2 49 gctgg GGACGTCGGTCACGAATGGCTGG gcgcc 71 0.68 Rv1733c complement(1959853..1960485) Rv1734c compl 6, 3 129 ggata AGGGACTTTCGCCCCTTCCCGCC tgctg 151 0.84 Rv1733c complement(1959853..1960485) Rv1734c compl 7, 1 259 gacca AGGATGATGGTCCCGGTCGCGAC gggcg 281 0.70 Rv3127 3492144..3493178 Rv3125c complement(3490473 7, 2 437 agagg ACCAATGACCCTATTTGATCAAA ccgga 459 0.80 Rv3127 3492144..3493178 Rv3125c complement(3490473 13, 1 249 ggtta ATGCCAGTTGCCCTTGGGCGCAG atgtt 271 0.67 Wilcoxon Shuffled Sequence 6 Num Sites: 16 Column 1 : Sequence Number, Site Number Column 2 : Left End Location Column 4 : Motif Element Column 6 : Right End Location Column 7 : Probability of Element Column 8 : Sequence Description from FastA input ======================= Wilcoxon Signed-rank Test for Centroid Model ======================== wilcox.test 1.02 Aug 24 2004 Exact Wilcoxon Signed-rank Test The exact p-value = 0.000046; the sample size = 16 alternative hypothesis: true mu is LESS than 0.000000 ====================================================================== ======================== Aligned Centroid Sites ====================== ====================================================================== ------------------------------------------------------------------------- MOTIF a Motif model (residue frequency x 100) ____________________________________________ Pos. # a t c g Info _____________________________ 1 | 50 6 12 31 0.4 2 | 25 . 6 68 0.5 3 | 6 12 . 81 0.7 4 | . . . 100 1.2 5 | 62 6 25 6 0.7 6 | . 6 93 . 1.1 7 | 31 18 18 31 0.1 8 | 37 43 . 18 0.6 9 | 43 43 12 . 0.7 10 | 31 31 18 18 0.2 11 | . . . 100 1.2 12 | 18 43 25 12 0.2 13 | . . 100 . 1.4 14 | 6 6 87 . 0.9 15 | . 18 68 12 0.5 16 | . 43 43 12 0.5 nonsite 18 19 29 33 site 19 17 32 30 Motif probability model ____________________________________________ Pos. # a t c g ____________________________________________ 1 | 0.471 0.075 0.140 0.314 2 | 0.244 0.018 0.083 0.655 3 | 0.073 0.131 0.026 0.769 4 | 0.016 0.018 0.026 0.939 5 | 0.585 0.075 0.254 0.087 6 | 0.016 0.075 0.879 0.030 7 | 0.300 0.188 0.197 0.314 8 | 0.357 0.415 0.026 0.201 9 | 0.414 0.415 0.140 0.030 10 | 0.300 0.302 0.197 0.201 11 | 0.016 0.018 0.026 0.939 12 | 0.187 0.415 0.254 0.144 13 | 0.016 0.018 0.936 0.030 14 | 0.073 0.075 0.822 0.030 15 | 0.016 0.188 0.651 0.144 16 | 0.016 0.415 0.424 0.144 Background probability model 0.166 0.214 0.263 0.357 16 columns Num Motifs: 16 1, 1 65 gggct AGGGACAGAAGTCCCC gaagc 80 1.00 F hspX complement(2278496..2278930) Rv2032 2279127.. 1, 2 87 aagcg CGGGCCATTTGTCCGC gcccg 102 1.00 F hspX complement(2278496..2278930) Rv2032 2279127.. 1, 3 122 cactt GGGGACCATTGACCCT gttgt 137 1.00 F hspX complement(2278496..2278930) Rv2032 2279127.. 2, 1 77 gaggc AGGGCCAAAGGTCCTC cgctg 92 1.00 F Rv3130c complement(3494972..3496363) Rv3131 349654 3, 1 54 ggtca TGAGGCTTTAGTCCCC aatcg 69 0.96 F Rv2005c complement(2250994..2251881) otsB 2252000. 4, 1 7 ccatt GAGGACCTAAGCCCGT tgggc 22 1.00 F Rv2623 2949591..2950484 Rv2622 2948634..2949455 4, 2 29 gggct AGTGACAAACGCCTCC tgagc 44 1.00 F Rv2623 2949591..2950484 Rv2622 2948634..2949455 5, 1 93 cagtt AGGGCCGGAAGTCCCC aatgt 108 1.00 F narK2 complement(1964181..1965368) Rv1738 1965655. 5, 2 133 ccctg GCGGACGAATGACCCC agtgg 148 1.00 F narK2 complement(1964181..1965368) Rv1738 1965655. 5, 3 155 gtggc CGGGACTTCAGGCCCT atcgg 170 1.00 F narK2 complement(1964181..1965368) Rv1738 1965655. 6, 1 25 ctcct AGGGTCGTTCGGCCTT ggggc 40 1.00 F Rv1733c complement(1959853..1960485) Rv1734c compl 6, 2 47 gggct GGGGACGTCGGTCACG aatgg 62 1.00 F Rv1733c complement(1959853..1960485) Rv1734c compl 6, 3 129 ggata AGGGACTTTCGCCCCT tcccg 144 1.00 F Rv1733c complement(1959853..1960485) Rv1734c compl 7, 1 258 ggacc AAGGATGATGGTCCCG gtcgc 273 1.00 F Rv3127 3492144..3493178 Rv3125c complement(3490473 7, 2 433 attga GAGGACCAATGACCCT atttg 448 1.00 F Rv3127 3492144..3493178 Rv3125c complement(3490473 13, 1 248 tggtt AATGCCAGTTGCCCTT gggcg 263 1.00 F Wilcoxon Shuffled Sequence 6 **************** Column 1 : Sequence Number, Site Number Column 2 : Left End Location Column 4 : Motif Element Column 6 : Right End Location Column 7 : Probability of Element Column 8 : Forward Motif (F) or Reverse Complement (R) Column 9 : Sequence Description from Fast A input Elapsed time: 1009.740000 secs