Gibbs.linux hypoxia.fa 16,16 -n -r -R 1,1,8,2,1,8 -M 1,24,2,24 -E 3 -S 20 -m -y -nopt -bayes 2000,8000 -align_centroid -B hypoxia.fa_info-det -o hypoxia.3.out Gibbs 3.01.002 Feb 19 2007 Data file: hypoxia.fa Output file: hypoxia.3.out Background Composition Model file: hypoxia.fa_info-det Current directory: /home/leeann/Gibbs_tests The following options are set: Concentrated Region False Sequence type False Collapsed Alphabet False Pseudocount weight False Use Expectation/Maximization False Don't Xnu sequence False Help flag False Near optimal cutoff False Number of iterations False Don't fragment False Don't use map maximization True Repeat regions False Output file True Informed priors file False Plateau periods False palindromic sequence True Don't Reverse complement True Number of seeds True Seed Value False Pseudosite weight False Suboptimal sampler output False Overlap False Allow width to vary False Wilcoxon signed rank False Sample along length False Output Scan File False Output prior file False Modular Sampler True Ignore Spacing Model False Sample Background False Bkgnd Comp Model True Init from prior False Homologous Seq pairs False Parallel Tempering False Group Sampler False No progress info False Fragment from middle False Verify Mode False Alternate sample on k False No freq. soln. True Calc. def. pseudo wt. False Motif/Recur smpl False Phylogenetic Sampling False Supress Near Opt. True Nearopt display cutoff False Sample model True Hierarchical Model False Centroid model True Print Bayesian Counts False Align Centroid True site_samp = 0 nMotifLen = 16, 16 nAlphaLen = 4 nNumMotifs = 16 ,16 dPseudoCntWt = 0.1 dPseudoSiteWt = 0.8 nMaxIterations = 500 lSeedVal = 1176147898 nPlateauPeriods = 20 nSeeds = 20 nNumMotifTypes = 2 dCutoff = 0.01 dNearOptDispCutoff = 0.5 RevComplement = 0 glOverlapParam = 0 Max Sites/seq = 3 Min Sites/Seq = 0 Rcutoff factor = 0 Post Plateau Samples = 0 Frag/Shft Per. = 5 Frag width = 24,24 Burn-in = 2000 Sample Period = 8000 Sequences to be Searched: _________________________ #1 Rv0079 88202..89023 Rv0078 86526..87131 5UTR genome coordinates=87132-88201 length=1070 #2 Rv0081 89573..89917 Rv0080 89020..89478 5UTR genome coordinates=89479-89572 length=94 #3 Rv0569 661001..661267 Rv0568 659448..660866 5UTR genome coordinates=660867-661000 length=134 #4 Rv0572c complement(665040..665381) Rv0573c complement(665849..667240) 5UTR genome coordinates=665382-665848 length=467 #5 Rv0574c complement(667250..668392) Rv0575c complement(668577..669743) 5UTR genome coordinates=668393-668576 length=184 #6 Rv1264 1411892..1413085 amiB2 1410429..1411817 5UTR genome coordinates=1411818-1411891 length=74 #7 Rv1592c complement(1792398..1793738) Rv1593c complement(1793995..1794705) 5UTR genome coordinates=1793739-1793994 length=256 #8 Rv1733c complement(1959853..1960485) Rv1734c complement(1960772..1961014) 5UTR genome coordinates=1960486-1960771 length=286 #9 Rv1734c complement(1960772..1961014) Rv1735c complement(1961289..1961786) 5UTR genome coordinates=1961015-1961288 length=274 #10 narK2 complement(1964181..1965368) Rv1738 1965655..1965939 5UTR genome coordinates=1965369-1965654 length=286 #11 Rv1739c complement(1965953..1967635) Rv1740 1967703..1967915 5UTR genome coordinates=1967636-1967702 length=67 #12 Rv1813c complement(2055679..2056110) Rv1814 2056519..2057421 5UTR genome coordinates=2056111-2056518 length=408 #13 ctpF 2240157..2242874 Rv1996 2239002..2239955 5UTR genome coordinates=2239956-2240156 length=201 #14 Rv1998c complement(2242943..2243719) Rv1999c complement(2243814..2245136) 5UTR genome coordinates=2243720-2243813 length=94 #15 Rv2003c complement(2248561..2249418) Rv2004c complement(2249476..2250972) 5UTR genome coordinates=2249419-2249475 length=57 #16 Rv2005c complement(2250994..2251881) otsB 2252000..2255983 5UTR genome coordinates=2251882-2251999 length=118 #17 fdxA complement(2256082..2256426) Rv2008c complement(2256615..2257940) 5UTR genome coordinates=2256427-2256614 length=188 #18 hspX complement(2278496..2278930) Rv2032 2279127..2280122 5UTR genome coordinates=2278931-2279126 length=196 #19 proA complement(2724228..2725475) ahpC 2726191..2726778 5UTR genome coordinates=2725476-2726190 length=715 #20 Rv2623 2949591..2950484 Rv2622 2948634..2949455 5UTR genome coordinates=2949456-2949590 length=135 #21 Rv2625c complement(2951320..2952501) Rv2626c complement(2952560..2952991) 5UTR genome coordinates=2952502-2952559 length=58 #22 Rv2626c complement(2952560..2952991) Rv2627c complement(2953505..2954746) 5UTR genome coordinates=2952992-2953504 length=513 #23 Rv2627c complement(2953505..2954746) Rv2628 2955056..2955418 5UTR genome coordinates=2954747-2955055 length=309 #24 Rv2629 2955765..2956889 Rv2628 2955056..2955418 5UTR genome coordinates=2955419-2955764 length=346 #25 Rv2659c complement(2979688..2980815) Rv2660c complement(2980960..2981187) 5UTR genome coordinates=2980816-2980959 length=144 #26 Rv3127 3492144..3493178 Rv3125c complement(3490473..3491648) 5UTR genome coordinates=3491649-3492143 length=495 #27 Rv3128c complement(3493165..3494178) Rv3129 3494657..3494989 5UTR genome coordinates=3494179-3494656 length=478 #28 Rv3130c complement(3494972..3496363) Rv3131 3496548..3497546 5UTR genome coordinates=3496364-3496547 length=184 #29 Rv3133c complement(3499259..3499912) Rv3134c complement(3499940..3500746) 5UTR genome coordinates=3499913-3499939 length=27 #30 Rv3134c complement(3499940..3500746) PPE__e290950 3501331..3501729 5UTR genome coordinates=3500747-3501330 length=584 #31 bfrB 4314175..4314720 Rv3840 4313564..4313977 5UTR genome coordinates=4313978-4314174 length=197 #32 pcnA complement(4391628..4393070) Rv3908 4393446..4394192 5UTR genome coordinates=4393071-4393445 length=375 Processed Sequence Length: 9014 Total sequence length: 9014 ====================================================================== ========================== CENTROID RESULTS ========================== ====================================================================== 1, 1 983 ttggc ATGGGACTTTCGGCCCTGTCCGC gtccg 1005 0.75 Rv0079 88202..89023 Rv0078 86526..87131 5UTR ge 3, 1 44 cgagg GGACTTTTGGCCACCGG cgctg 60 0.83 Rv0569 661001..661267 Rv0568 659448..660866 5UT 3, 2 61 accgg CGCTGGTGGCCTACTGC cctcc 77 0.66 Rv0569 661001..661267 Rv0568 659448..660866 5UT 5, 1 88 ggcct CGTGGGTGGGGCCGAAGGTCCTC aagac 110 0.90 Rv0574c complement(667250..668392) Rv0575c complem 8, 1 23 ggctc CTAGGGTCGTTCGGCCTTGGGGC tgggg 45 0.84 Rv1733c complement(1959853..1960485) Rv1734c compl 8, 2 49 gctgg GGACGTCGGTCACGAATGGCTGG gcgcc 71 0.77 Rv1733c complement(1959853..1960485) Rv1734c compl 8, 3 123 attgt CGGATAAGGGACTTTCGCCCCTT cccgc 145 0.93 Rv1733c complement(1959853..1960485) Rv1734c compl 9, 1 24 tagct CCGAGCCCGGGGACTTCGGTCCC cagag 46 0.87 Rv1734c complement(1960772..1961014) Rv1735c compl 10, 1 91 ctcag TTAGGGCCGGAAGTCCCCAATGT ggcag 113 0.93 narK2 complement(1964181..1965368) Rv1738 1965655. 10, 2 127 tttcg CCCCTGGCGGACGAATGACCCCA gtggc 149 0.80 narK2 complement(1964181..1965368) Rv1738 1965655. 10, 3 159 ccggg ACTTCAGGCCCTATCGGAGGGCT ccggc 181 0.86 narK2 complement(1964181..1965368) Rv1738 1965655. 12, 1 260 agggc ATAAAGTCTCTAACAGCACCG accgg 280 0.79 Rv1813c complement(2055679..2056110) Rv1814 205651 12, 2 287 ccgga TAGGGAACAACGGCCTTCGGGCA agcgg 309 0.86 Rv1813c complement(2055679..2056110) Rv1814 205651 13, 1 85 ggcca GCAGCGCTGGACCGTAGGTCCCT gcagt 107 0.60 ctpF 2240157..2242874 Rv1996 2239002..2239955 5 13, 2 113 gcagt GGATGACTTACGGCCCTGATCCA caccg 135 0.89 ctpF 2240157..2242874 Rv1996 2239002..2239955 5 16, 1 43 ggaca GTCACCGGTCATGAGGCTTTAGT cccca 65 0.70 Rv2005c complement(2250994..2251881) otsB 2252000. 17, 1 60 ccgga AAGGACCAAAGGCCTTATTCGTC aagtt 82 0.99 fdxA complement(2256082..2256426) Rv2008c compleme 18, 1 66 ggcta GGGACAGAAGTCCCCGAAGCGCG ggcca 88 0.89 hspX complement(2278496..2278930) Rv2032 2279127.. 18, 2 91 gcggg CCATTTGTCCGCGCCCGTCGGTG atcca 113 0.62 hspX complement(2278496..2278930) Rv2032 2279127.. 18, 3 117 tgatc CACTTGGGGACCATTGACCCTGT tgtct 139 0.94 hspX complement(2278496..2278930) Rv2032 2279127.. 20, 1 7 ccatt GAGGACCTAAGCCCGTT gggct 23 0.85 Rv2623 2949591..2950484 Rv2622 2948634..2949455 20, 2 24 ccgtt GGGCTAGTGACAAACGCCT cctga 42 0.70 Rv2623 2949591..2950484 Rv2622 2948634..2949455 22, 1 72 aacac TAGGGTCGTTTGACCCGTGGGCC gcggg 94 0.78 Rv2626c complement(2952560..2952991) Rv2627c compl 22, 2 236 ccgat AGTGATGCCGATCGGCCCCGATC ggggt 258 0.64 Rv2626c complement(2952560..2952991) Rv2627c compl 23, 1 25 tgcgg AACGACGCGTTAGGGACTTACGT cccgc 47 0.91 Rv2627c complement(2953505..2954746) Rv2628 295505 23, 2 269 tgggc CAGTGAAGTGACGAAAGACCCCA gtgga 291 0.96 Rv2627c complement(2953505..2954746) Rv2628 295505 24, 1 41 gccga TCCGGTGGATGACTTTGGTCCCT atgcc 63 0.91 Rv2629 2955765..2956889 Rv2628 2955056..2955418 26, 1 436 gagag GACCAATGACCCTATTTGATCAA accgg 458 0.92 Rv3127 3492144..3493178 Rv3125c complement(3490473 28, 1 75 ttgag GCAGGGCCAAAGGTCCTCCGCTG gcgag 97 0.89 Rv3130c complement(3494972..3496363) Rv3131 349654 30, 1 72 tatct CCCAGGGGCGTTGGTCCCCACCT gaggg 94 0.87 Rv3134c complement(3499940..3500746) PPE__e290950 30, 2 97 cctga GGGCCGTTAGTCCTTATCGACCG atgac 119 0.93 Rv3134c complement(3499940..3500746) PPE__e290950 Num Sites: 31 Column 1 : Sequence Number, Site Number Column 2 : Left End Location Column 4 : Motif Element Column 6 : Right End Location Column 7 : Probability of Element Column 8 : Sequence Description from FastA input ====================================================================== ======================== Aligned Centroid Sites ====================== ====================================================================== ------------------------------------------------------------------------- MOTIF a No Motifs Detected ------------------------------------------------------------------------- MOTIF b Motif model (residue frequency x 100) ____________________________________________ Pos. # a t c g Info _____________________________ 1 | 45 9 6 38 0.4 2 | 19 . 3 77 0.8 3 | 3 19 . 77 0.7 4 | 3 . . 96 1.2 5 | 58 6 25 9 0.6 6 | 6 . 93 . 1.2 7 | 12 32 19 35 0.1 8 | 35 58 . 6 1.0 9 | 51 38 9 . 0.9 10 | 29 19 29 22 0.1 11 | . 3 . 96 1.2 12 | 16 45 9 29 0.3 13 | . . 100 . 1.5 14 | 3 6 90 . 1.1 15 | 3 19 70 6 0.6 16 | . 48 41 9 0.6 nonsite 17 18 30 33 site 17 19 31 31 Motif probability model ____________________________________________ Pos. # a t c g ____________________________________________ 1 | 0.439 0.101 0.076 0.385 2 | 0.193 0.009 0.045 0.754 3 | 0.039 0.193 0.014 0.754 4 | 0.039 0.009 0.014 0.938 5 | 0.562 0.070 0.260 0.108 6 | 0.070 0.009 0.906 0.015 7 | 0.131 0.316 0.199 0.354 8 | 0.347 0.563 0.014 0.077 9 | 0.500 0.378 0.106 0.015 10 | 0.285 0.193 0.291 0.231 11 | 0.008 0.040 0.014 0.938 12 | 0.162 0.440 0.106 0.292 13 | 0.008 0.009 0.968 0.015 14 | 0.039 0.070 0.876 0.015 15 | 0.039 0.193 0.691 0.077 16 | 0.008 0.470 0.414 0.108 Background probability model 0.169 0.187 0.294 0.350 16 columns Num Motifs: 31 1, 1 984 tggca TGGGACTTTCGGCCCT gtccg 999 1.00 F Rv0079 88202..89023 Rv0078 86526..87131 5UTR ge 3, 1 42 cccga GGGGACTTTTGGCCAC cggcg 57 1.00 F Rv0569 661001..661267 Rv0568 659448..660866 5UT 3, 2 65 gcgct GGTGGCCTACTGCCCT cccgc 80 1.00 F Rv0569 661001..661267 Rv0568 659448..660866 5UT 5, 1 95 tgggt GGGGCCGAAGGTCCTC aagac 110 1.00 F Rv0574c complement(667250..668392) Rv0575c complem 8, 1 25 ctcct AGGGTCGTTCGGCCTT ggggc 40 1.00 F Rv1733c complement(1959853..1960485) Rv1734c compl 8, 2 47 gggct GGGGACGTCGGTCACG aatgg 62 1.00 F Rv1733c complement(1959853..1960485) Rv1734c compl 8, 3 129 ggata AGGGACTTTCGCCCCT tcccg 144 1.00 F Rv1733c complement(1959853..1960485) Rv1734c compl 9, 1 32 agccc GGGGACTTCGGTCCCC agagc 47 1.00 F Rv1734c complement(1960772..1961014) Rv1735c compl 10, 1 93 cagtt AGGGCCGGAAGTCCCC aatgt 108 1.00 F narK2 complement(1964181..1965368) Rv1738 1965655. 10, 2 133 ccctg GCGGACGAATGACCCC agtgg 148 1.00 F narK2 complement(1964181..1965368) Rv1738 1965655. 10, 3 155 gtggc CGGGACTTCAGGCCCT atcgg 170 1.00 F narK2 complement(1964181..1965368) Rv1738 1965655. 12, 1 255 cgggt AGGGCATAAAGTCTCT aacag 270 1.00 F Rv1813c complement(2055679..2056110) Rv1814 205651 12, 2 288 cggat AGGGAACAACGGCCTT cgggc 303 1.00 F Rv1813c complement(2055679..2056110) Rv1814 205651 13, 1 92 agcgc TGGACCGTAGGTCCCT gcagt 107 0.98 F ctpF 2240157..2242874 Rv1996 2239002..2239955 5 13, 2 114 cagtg GATGACTTACGGCCCT gatcc 129 1.00 F ctpF 2240157..2242874 Rv1996 2239002..2239955 5 16, 1 54 ggtca TGAGGCTTTAGTCCCC aatcg 69 1.00 F Rv2005c complement(2250994..2251881) otsB 2252000. 17, 1 60 ccgga AAGGACCAAAGGCCTT attcg 75 1.00 F fdxA complement(2256082..2256426) Rv2008c compleme 18, 1 65 gggct AGGGACAGAAGTCCCC gaagc 80 1.00 F hspX complement(2278496..2278930) Rv2032 2279127.. 18, 2 87 aagcg CGGGCCATTTGTCCGC gcccg 102 1.00 F hspX complement(2278496..2278930) Rv2032 2279127.. 18, 3 122 cactt GGGGACCATTGACCCT gttgt 137 1.00 F hspX complement(2278496..2278930) Rv2032 2279127.. 20, 1 7 ccatt GAGGACCTAAGCCCGT tgggc 22 1.00 F Rv2623 2949591..2950484 Rv2622 2948634..2949455 20, 2 29 gggct AGTGACAAACGCCTCC tgagc 44 1.00 F Rv2623 2949591..2950484 Rv2622 2948634..2949455 22, 1 73 acact AGGGTCGTTTGACCCG tgggc 88 1.00 F Rv2626c complement(2952560..2952991) Rv2627c compl 22, 2 239 atagt GATGCCGATCGGCCCC gatcg 254 1.00 F Rv2626c complement(2952560..2952991) Rv2627c compl 23, 1 36 gcgtt AGGGACTTACGTCCCG ccgga 51 1.00 F Rv2627c complement(2953505..2954746) Rv2628 295505 23, 2 275 agtga AGTGACGAAAGACCCC agtgg 290 1.00 F Rv2627c complement(2953505..2954746) Rv2628 295505 24, 1 48 cggtg GATGACTTTGGTCCCT atgcc 63 1.00 F Rv2629 2955765..2956889 Rv2628 2955056..2955418 26, 1 433 attga GAGGACCAATGACCCT atttg 448 1.00 F Rv3127 3492144..3493178 Rv3125c complement(3490473 28, 1 77 gaggc AGGGCCAAAGGTCCTC cgctg 92 1.00 F Rv3130c complement(3494972..3496363) Rv3131 349654 30, 1 75 ctccc AGGGGCGTTGGTCCCC acctg 90 1.00 F Rv3134c complement(3499940..3500746) PPE__e290950 30, 2 96 acctg AGGGCCGTTAGTCCTT atcga 111 1.00 F Rv3134c complement(3499940..3500746) PPE__e290950 **************** Column 1 : Sequence Number, Site Number Column 2 : Left End Location Column 4 : Motif Element Column 6 : Right End Location Column 7 : Probability of Element Column 8 : Forward Motif (F) or Reverse Complement (R) Column 9 : Sequence Description from Fast A input Elapsed time: 22374.710000 secs