Results of the Bayesian Phylogentic Footprint


Alignment of query and comparison sequence for HELP SAMPLE

The above example shows the detailed relationship between the two sequences. From this graph you can see that there are at least 3 major blocks conserved in the query sequence (1-67,72-105,257-263) The data used to generate this plot is in "Probability Profile" File which can be viewed by clicking on the url near the bottom of this page.
Probability of residue conservation in query sequence for HELP SAMPLE

The above example graphs the probability of conservation of each residue in the query sequence. This is equivalent to collapsing the "Alignment of query and comparison sequence" graph along the data(comparison) axis. The data for this graph is in the "Marginal probability of the query sequence" file which can be viewed by clicking on the url near the bottom of this page.


Temperature plot of residue conservation in query sequence

> 1A human I1 ifn_gene_human v00536 and m32746 small
12
GTATGACTTTTTAATAGTACTTGTTTGTGGTTGAAAATGACTGAATATCGACTTGCTGT
606768727379819092105106109
AGCATCTCTGATAGGCTGTCATCTCTTGTAGGCAGTCATTTTGAGATTTGGTGTTATTT
119
TGTTAATTATTGACTAGATGAGTTCCTTGACTAAATAATCTAGATATTGTTTTAACCTT
178
CTGCTCAGTTTGTATAGAGACTTAAAAGGGATTTATGAATTTTCCAAAAGATGGGCATA
237256257263264
ATATGGGTATGAAGCATAATGATGTTAATAATTTTGTGGTGGGAACTCATTCAGTTGTG
296
ATAGTCAAGGAGTATGCAGATTGAAAAAAATGATTGGTTATTAGTTTTTGACTTCTCAG
355
ACTCTAAGGTCAAGATTAGCATTAAAAAGGTAATAGGAAATGTTTACAAATTAAAGTCA
414
AAAAGGTCCTTAAAGCTTTGGCTTAAAAAAATAACTGATAGGTGATTTTCTCCAAAAAG
473
TGATTTCAACATTCTGCTTCTCTATCTATATTACTTGTGAAGTATTCCGGAACTTCGTT

Color Key for Probability of Conservation
0-0.199 0.2-0.399 0.4-0.599 0.6-0.799 0.8-0.999
         
The above example show the probability of conservation of each residue in the query sequence. This is equivalent to collapsing "Alignment of query and comparison sequence" graph along the data(comparison) axis. This is the same as the "Probability of residue conservation in query sequence" graph but shown as a temperature plot instead. The color red means that the base is highly conserved and the color blue means it is poorly conserved. The data for this graph is in the "Marginal probability of the query sequence file" which can be viewed by clicking on the url near the bottom of this page.

Data files

The URLs above are the data files used to make the graphs and other important information.

The "Run file output" includes the various probabilities for the number of conserved blocks. This example shows that probability that there are exactly 3 conserved blocks is 0.281207 and the probability that there are more than 3 conserved blocks is 0.633378.

The "Block alignment file" includes the most probable block alignments. In this example it shows that the most probable conserved blocks are
(1-67) (72-105) and (256-263)
(see Bioinformatics 1998;14(1):25-39 for detail explanation of bayesian aligner)


Back to Bayesian Phylogenetic Footprint Homepage